View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270-Insertion-10 (Length: 85)
Name: NF4270-Insertion-10
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270-Insertion-10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 2e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 2e-39
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 34894630 - 34894549
Alignment:
| Q |
2 |
gaaaaactaattaactttgcttttgttgcttccaaagttacaaacttccctctagtgatgttttgtttttggaaacttggta |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34894630 |
gaaaaactaattaactttgcttttgttgcttccaaagttacaaacttccctctagtgatgttttgtttttggaaacttggta |
34894549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University