View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270-Insertion-15 (Length: 91)
Name: NF4270-Insertion-15
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270-Insertion-15 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 3e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 42378145 - 42378235
Alignment:
| Q |
1 |
tttatcaattctatccagcaaacccttgctcttcactcattgtctgaagctaccgtctctgtttttctatttgtgcacccttgcagtctta |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42378145 |
tttatcaattctatccagcaaacccttgctcttcactcattgtctgaagctaccgtctctgtttttctattcgtgcacccttgcagtctta |
42378235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 42406859 - 42406949
Alignment:
| Q |
1 |
tttatcaattctatccagcaaacccttgctcttcactcattgtctgaagctaccgtctctgtttttctatttgtgcacccttgcagtctta |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42406859 |
tttatcaattctatccagcaaacccttgctcttcactcattgtctgaagctaccgtctctgtttttctattcgtgcacccttgcagtctta |
42406949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University