View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270-Insertion-3 (Length: 179)
Name: NF4270-Insertion-3
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270-Insertion-3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 38584339 - 38584161
Alignment:
| Q |
1 |
gttatatcagaggactatttcctgagaagtacttcaatgacaagtctgttcccgcgttaggtaaaatcactattcagtcctccagttgtttgcgtttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584339 |
gttatatcagaggactatttcctgagaagtacttcaatgacaagtctgttcccgcgttaggtaaaatcactattcagtcctccagttgtttgcgtttttt |
38584240 |
T |
|
| Q |
101 |
actgtttagtgtttacactgaatcttctagtatttgtccttgaatttaacctataactatgctttaataacagagatga |
179 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584239 |
actgtttaatgtttacactgaatcttctagtatttgtccttgaatttaacctataactatgctttaataacagagatga |
38584161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University