View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270-Insertion-6 (Length: 135)
Name: NF4270-Insertion-6
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270-Insertion-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 13336190 - 13336056
Alignment:
| Q |
1 |
agtacgacggagattacgggaagggatggatggtgagaggaaggagtacgacggagacggagatatgaacagaaaaagtggaacttgggtcttgctgtga |
100 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13336190 |
agtacggcggagattatgggaagggatggatggtgagaggaaggagtacgacggagacggagatatgaacagaaaaagtggaacttgggtcttgctgtga |
13336091 |
T |
|
| Q |
101 |
ttattctttcccaaatcttcaacttcttcttcctc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13336090 |
ttattctttcccaaatcttcaacttcttcttcctc |
13336056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 135
Target Start/End: Complemental strand, 4462769 - 4462642
Alignment:
| Q |
8 |
cggagattacgggaagggatggatggtgagaggaaggagtacgacggagacggagatatgaacagaaaaagtggaacttgggtcttgctgtgattattct |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4462769 |
cggagattacgggaaggaatggatggtgagagggaggagtacgacggagacggagatatgaacagaaaaagaggaacttgggtcttgctgtgattattct |
4462670 |
T |
|
| Q |
108 |
ttcccaaatcttcaacttcttcttcctc |
135 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
4462669 |
ttccaaaatcttcaacttcttcttcctc |
4462642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 7e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 7e-44
Query Start/End: Original strand, 9 - 135
Target Start/End: Original strand, 36380894 - 36381024
Alignment:
| Q |
9 |
ggagattacgggaagggatggatggtgagaggaaggagtacgacggagacggagatatgaacagaaaaagtggaact----tgggtcttgctgtgattat |
104 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
36380894 |
ggagattacgagaagggatggatgttgagagggaggagtacgacggagacggagatatgaacagaaaaggaggaacttgggtgggtcttgctgtgattat |
36380993 |
T |
|
| Q |
105 |
tctttcccaaatcttcaacttcttcttcctc |
135 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |
|
|
| T |
36380994 |
tctttcccaaatcttcaatttcttcttcctc |
36381024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University