View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270-Insertion-9 (Length: 88)
Name: NF4270-Insertion-9
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270-Insertion-9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 1e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 12 - 88
Target Start/End: Complemental strand, 7065868 - 7065792
Alignment:
| Q |
12 |
ttaggaacaatatcatctgtataattttaggaggtatttattccattcatcaattgtattgtagatggccttcttag |
88 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7065868 |
ttaggaacagtatcatctgtataattttaggaggtatttattccattcatcaattgtattgtagacggccttcttag |
7065792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University