View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_high_20 (Length: 321)
Name: NF4270_high_20
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 5 - 302
Target Start/End: Original strand, 45512231 - 45512528
Alignment:
| Q |
5 |
gagtgagatgaaaaccatcattcaattatttcaatagaaacagagatagaaaacatgggaagatattacaaatgtgtagtacttttggtgttgattgaaa |
104 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512231 |
gagtgaaatgaaaaccatcattcaattatttcaatagaaacagagatagaaaacatgggaagatattacaaatgtgtagtacttttggtgttgattgaaa |
45512330 |
T |
 |
| Q |
105 |
ttgcacaaatatgcttgtgtgtaaattcaaacatcccctgtattgaaaaagagaggcaagcccttctcaatttcaaagcatccattgcacatgattcacc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512331 |
ttgcacaaatatgcttgtgtgtaaattcaaacatcccctgtattgaaaaagagaggcaagcccttctcaatttcaaagcatccattgcacatgattcacc |
45512430 |
T |
 |
| Q |
205 |
aaacaagctttcatcatggaaaggcactcactgttgccaatgggaaggcattggttgtgacaatgttactagacatgttgtcaaacttgatctcatga |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512431 |
aaacaagctttcatcatggaaaggcactcactgttgccaatgggaaggcattggttgtgacaatgttactagacatgttgtcaaacttgatctcatga |
45512528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University