View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_high_31 (Length: 255)
Name: NF4270_high_31
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 26 - 244
Target Start/End: Original strand, 41991082 - 41991300
Alignment:
| Q |
26 |
ggtcaagccctttgcatctcttttattcaccccttattacaagcacaccaaattttaattttcaactgaatattactgagaaacaatgattgtgttttta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41991082 |
ggtcaagccctttgcatctcttttattcaccccttattacaagcacaccaaattttaattttcaactgaatattactgagaaacaatgattgtgttttta |
41991181 |
T |
 |
| Q |
126 |
atccggtgaagtgataaaatctaatctcgatccccaatagtaatccagtgaggagagtttcactctacactcgtgtgattataacacacacactaatcgc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41991182 |
atccggtgaagtgataaaatctaatctcgatccccaatagtaatccagtgaggagagtttcactctacactcgtgtgattataacacacacactaatcgc |
41991281 |
T |
 |
| Q |
226 |
ccatcgcagcctttcttct |
244 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41991282 |
ccatcgcagcctttcttct |
41991300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University