View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4270_high_44 (Length: 238)

Name: NF4270_high_44
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4270_high_44
NF4270_high_44
[»] chr8 (2 HSPs)
chr8 (112-209)||(10695365-10695469)
chr8 (116-144)||(10708321-10708349)


Alignment Details
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 112 - 209
Target Start/End: Original strand, 10695365 - 10695469
Alignment:
112 ggaataaaggtttaagcaccaaagtaaatagatcttttaattcaattataaaatgattg-------ctgagatcctatatttaaaagtagtgacgttatt 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||    
10695365 ggaataaaggtttaagcaccaaagtaaatagatcttttaattcaattataaaatgattgctgagacctgagatcctatatttaaaagtagtgacgttatt 10695464  T
205 ccctc 209  Q
    |||||    
10695465 ccctc 10695469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 144
Target Start/End: Original strand, 10708321 - 10708349
Alignment:
116 taaaggtttaagcaccaaagtaaatagat 144  Q
    |||||||||||||||||||||||||||||    
10708321 taaaggtttaagcaccaaagtaaatagat 10708349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University