View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_high_48 (Length: 226)
Name: NF4270_high_48
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_high_48 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 30 - 226
Target Start/End: Original strand, 30975149 - 30975345
Alignment:
| Q |
30 |
aagtagttattttcgtgagaatttcttaccggcgatggtaggaaacaactcagcaaccaccgtcagccacctaccggaggagattttatcgaaagtcttc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30975149 |
aagtagttattttcgtgagaatttcttaccggtgatggtaggaaacaactcagcaaccaccgtcagccacctaccggaggagattttatcgaaagtcttc |
30975248 |
T |
 |
| Q |
130 |
accggaataactgacacacgaactcgaaattcactctccttagtatgtcatagcttcttcaagttagagagaaaaacgcgattatccctcacgctcc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30975249 |
accggaataactgacacacgaactcgaaactcactctccttagtatgtcatagcttcttcaagttagagagaaaaacgcgattatccctcacgctcc |
30975345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University