View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_low_20 (Length: 334)
Name: NF4270_low_20
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 312; Significance: 1e-176; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 328
Target Start/End: Original strand, 30975325 - 30975652
Alignment:
| Q |
1 |
cgcgattatccctcacgctccgaggaaacgcgcgtgacttatacagaattccaacttccttcacgaacgttactcatctcgatgtatcgcttctctcgcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30975325 |
cgcgattatccctcacgctccgaggaaacgcgcgtgacttatacagaattccaacttccttcacgaacgttactcatctcgatgtatcacttctctcgcc |
30975424 |
T |
 |
| Q |
101 |
gtggggtcacgcgctgttctgttcacctgctggtaatgattctccgcttctagctcaacggttacgaaatactttcccgcgcgtgacttcactcactgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30975425 |
gtggggtcacgcgctgttctgttcacctgctggtaatgattctccgcttctagctcaacggttacgaaatactttcccgcgcgtgacttcactcactgtc |
30975524 |
T |
 |
| Q |
201 |
tacgtgcgtgacccgcacacgcttcaccttcttctcttcaaccactggccggagcttcgtgatgttcggcttgttcggtggcatcaacggccgcatgggt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30975525 |
tacgtgcgtgacccgcacacgcttcaccttcttctcttcaaccactggccggagcttcgtgatgttcggcttgttcggtggcatcaacggccgcaggggt |
30975624 |
T |
 |
| Q |
301 |
tgcaaccggggtcagagttcgccgcctt |
328 |
Q |
| |
|
|||||||||||||||| |||| |||||| |
|
|
| T |
30975625 |
tgcaaccggggtcagacttcgacgcctt |
30975652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 216 - 304
Target Start/End: Original strand, 49708168 - 49708256
Alignment:
| Q |
216 |
cacacgcttcaccttcttctcttcaaccactggccggagcttcgtgatgttcggcttgttcggtggcatcaacggccgcatgggttgca |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||| || | |||||||| |
|
|
| T |
49708168 |
cacacgcttcaccttcttctcttcaaccactggctggagcttcgtgatgttcatcttgttcggtggcaccaacgggcgtaggggttgca |
49708256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 216 - 304
Target Start/End: Original strand, 5141997 - 5142085
Alignment:
| Q |
216 |
cacacgcttcaccttcttctcttcaaccactggccggagcttcgtgatgttcggcttgttcggtggcatcaacggccgcatgggttgca |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||| || | |||||||| |
|
|
| T |
5141997 |
cacacgcttcaccttcttctcttcaaccactggctggagcttcgtgatgttcatcttgttcggtggcaccaacgggcgtaggggttgca |
5142085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University