View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_low_23 (Length: 319)
Name: NF4270_low_23
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 17 - 307
Target Start/End: Original strand, 35453456 - 35453745
Alignment:
| Q |
17 |
tcactattcctatcacttctcttttttctcaagctaatagctttaatatttgggttcaattatttctgaatgaggaacaaaagctgtgnnnnnnnngggg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35453456 |
tcactattcctatcacttctcttttttctcaagctaatagctttaatatttgggttcaattatttctgaatgaggaacaaaagctgtgaaaaaaa-gggg |
35453554 |
T |
 |
| Q |
117 |
tttggatgaaatttttgtaatttctgaagcttgaagcttcctttagttttaaccttttatggctcaaatgaattggnnnnnnngtggctttactgctctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35453555 |
tttggatgaaatttttgtaatttctgaagcttgaagcttcctttagttttaaccttttatggctcaaatgaattggtttttttgtggctttactgctctt |
35453654 |
T |
 |
| Q |
217 |
gatatgtcactgattgattgagtcctctattcttgtttagtctgaataccattgttgtgtgaacaggttttgctcaaatggtttgtggttc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35453655 |
gatatgtcactgattgattgagtcctctattcttgtttagtctgaataccattgttgtgtgaacaggttttgctcaaatggtttgtggttc |
35453745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University