View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_low_41 (Length: 246)
Name: NF4270_low_41
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 233
Target Start/End: Original strand, 24653971 - 24654192
Alignment:
| Q |
13 |
attctttacaaatggcaatgccgtttctggttttgtccattgcattatttcttctccataaaattaaaagaattgcatacatacaaatttatttacctca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24653971 |
attctttacaaatggcaatgccgtttctggttttgtccattgcattatttcttctccataaaattaaaagaattgcatacataaaaatttatttacctca |
24654070 |
T |
|
| Q |
113 |
tacaaatcattggaatccttatag-caacaaacatgtcacatgaaattattgaggagacagaggaagagtctcattggtttatcaacacaaaagatcaga |
211 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24654071 |
tacaaattattggaatccttatagacaacaaacatgtcacatgaaattattgaggagaaagaggaagagtctcattggtttatcaacacaaaagaacaga |
24654170 |
T |
|
| Q |
212 |
aggaaaagatcatgaagattat |
233 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24654171 |
aggaaaagatcatgaagattat |
24654192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University