View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_low_43 (Length: 244)
Name: NF4270_low_43
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_low_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 24947306 - 24947513
Alignment:
| Q |
18 |
atgaatcaagtgccagttgcatatttatcaatgatttagtaaaggtagctggtatataatttgaaaggaagatagtacaacatttgcatctttgttatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24947306 |
atgaatcaagtgccagttgcatatttatcaatgatttagtaaaggtagctggtatataatttgaaaggaagatagtacaacatttgcatctttgttatta |
24947405 |
T |
|
| Q |
118 |
agtttgaattgcatgctttctctcaattttttaacggttgcttagtaacaatctcttgttaaatagaaaaggatggatcctaatatcccattcacatatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24947406 |
agtttgaattgcatgctttctctcaattttttaacggttgcttagtaacaatctcatgttaaatagaaaaggatggatcctaatatcccattcacatatg |
24947505 |
T |
|
| Q |
218 |
ctgaattt |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
24947506 |
ctgaattt |
24947513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 106 - 169
Target Start/End: Original strand, 24954178 - 24954241
Alignment:
| Q |
106 |
tctttgttattaagtttgaattgcatgctttctctcaattttttaacggttgcttagtaacaat |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | | ||||||| |||||||||||| |||| |
|
|
| T |
24954178 |
tctttgttattaagtttgaattgcatgctttctgttagatttttaagggttgcttagtagcaat |
24954241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 39 - 84
Target Start/End: Original strand, 24954070 - 24954115
Alignment:
| Q |
39 |
tatttatcaatgatttagtaaaggtagctggtatataatttgaaag |
84 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||| |||||||||| |
|
|
| T |
24954070 |
tatttatcaatgattcagaaaaggtagctggaatacaatttgaaag |
24954115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University