View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_low_45 (Length: 239)
Name: NF4270_low_45
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 7 - 195
Target Start/End: Complemental strand, 41331323 - 41331127
Alignment:
| Q |
7 |
gccaatagcactctttggatgggtccacattggtcacggaattttgtttgaacatgtatatgtgac--------ctactaaaatactatttgctcttctc |
98 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41331323 |
gccaagagcactctttggatgggtccacattggtcacggaattttgtttcaacatgtatatgtgacattgtgacctactaaaatactatttgctcttctc |
41331224 |
T |
 |
| Q |
99 |
ccgtgaatatttgtaagcatctaaacaagacacgaagacactccctcccatgatcgatgccattgtcgatactcttcacggaccaaacttcattttc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41331223 |
ccgtgaatatttgtaagcatctaaacaagacacgaagacactccctcccatgatcgatgccattgtcgatactcttcacggaccaaacttcattttc |
41331127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 220
Target Start/End: Complemental strand, 41331104 - 41331072
Alignment:
| Q |
188 |
tcattttccatgtaaaatagacctgtgtattct |
220 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
41331104 |
tcattttccatgtaaaatagacctgtgcattct |
41331072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University