View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_low_47 (Length: 238)
Name: NF4270_low_47
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 112 - 209
Target Start/End: Original strand, 10695365 - 10695469
Alignment:
| Q |
112 |
ggaataaaggtttaagcaccaaagtaaatagatcttttaattcaattataaaatgattg-------ctgagatcctatatttaaaagtagtgacgttatt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10695365 |
ggaataaaggtttaagcaccaaagtaaatagatcttttaattcaattataaaatgattgctgagacctgagatcctatatttaaaagtagtgacgttatt |
10695464 |
T |
|
| Q |
205 |
ccctc |
209 |
Q |
| |
|
||||| |
|
|
| T |
10695465 |
ccctc |
10695469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 144
Target Start/End: Original strand, 10708321 - 10708349
Alignment:
| Q |
116 |
taaaggtttaagcaccaaagtaaatagat |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10708321 |
taaaggtttaagcaccaaagtaaatagat |
10708349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University