View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_low_49 (Length: 236)
Name: NF4270_low_49
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 12452787 - 12453011
Alignment:
| Q |
1 |
ccatgttattcttgatgctaacttagttggttctagcacttctttggttggaatttggaaattataccaaagcgtatttttatttcaacatgc---aaga |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
12452787 |
ccatgttattcttgatgctaacttagttggttctagcacttctttggttggaatttggaaattataccaaagcgtatttttatttcaatatgcaagaaga |
12452886 |
T |
 |
| Q |
98 |
atatttgattttaataagctttctttgtctagtttcatgctccatgaactaaggtaatgttgtgacaaccccccatccttagct-gatcaaatgtagtac |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12452887 |
atatttgattttaataagctttctttgtctagtctcatgctccatgaactaaggtaatgttgtgacaaccccccatccttagctagatcaaatgtagtac |
12452986 |
T |
 |
| Q |
197 |
tgatggttctcctaagggttgtgca |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
12452987 |
tgatggttctcctaagggttgtgca |
12453011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University