View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_low_52 (Length: 225)
Name: NF4270_low_52
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_low_52 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 225
Target Start/End: Original strand, 3308224 - 3308442
Alignment:
| Q |
7 |
tctctttcactcttccaacaacttcttcatcaccatcaccatcctcttcctcttccacaaccatgtctgattcaaactccggcatggtaatagcacgccg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308224 |
tctctttcactcttccaacaacttcttcatcaccatcaccatcctcttcctcttccacaaccatgtctgattcaaactccggcatggtaatagcacgccg |
3308323 |
T |
|
| Q |
107 |
gagagcagcaggcaaatcaggaagaggaggaggaggcaaaggaacatcataagaaggagagaataaaagattttgttgttgttctccttgtgcaaaatct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308324 |
gagagcagcaggcaaatcaggaagaggaggaggaggcaaaggaacatcataagaaggagagaataaaagattttgttgttgttctccttgtgcaaaatct |
3308423 |
T |
|
| Q |
207 |
atgagagccgcgccggtgt |
225 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3308424 |
atgagagccgcgccggtgt |
3308442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University