View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4270_low_6 (Length: 482)
Name: NF4270_low_6
Description: NF4270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4270_low_6 |
 |  |
|
| [»] scaffold0053 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-159; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 178 - 470
Target Start/End: Complemental strand, 9083374 - 9083082
Alignment:
| Q |
178 |
gagaattgtggtgatccgtttttggttttgttttgtaggttgcgggaagggcatttcagattgtgtttaatttaggttcatttggtttgaagctattatg |
277 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9083374 |
gagaattgtgttgatccgtttttggttttgttgtgtaggttgcgggaagggcatttcagattgtgtttaatttaggttcatttggtttgaagctattatg |
9083275 |
T |
 |
| Q |
278 |
ggagcagagaaatggagttgctgatcagaataaaaggattcgtgctattgagcttaggaatatattcactaagcttggaccaacttttgtcaaattgggt |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9083274 |
ggagcagagaaatggagttgctgatcagaataaaaggattcgtgctattgagcttaggaatatattcactaagcttggaccaacttttgtcaaattgggt |
9083175 |
T |
 |
| Q |
378 |
caagggctgtctactagacccgatatttgtccatctgagtatcttgaggagctttctgaacttcaagtattgaattcttaccttttggttttc |
470 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9083174 |
caagggctgtctactagacccgatatttgtccatctgagtatcttgaggagctttctgaacttcaagtattgaattcttaccttttggttttc |
9083082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 9083534 - 9083469
Alignment:
| Q |
18 |
gattggacgtgctacacgtcttcaatcacgtttttgatcataactgtgtgctacagaggttttgac |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9083534 |
gattggacgtgctacacgtcttcaatcacgtttttgatcataactgtgtgctacagaggttttgac |
9083469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0053 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 339 - 415
Target Start/End: Original strand, 17246 - 17322
Alignment:
| Q |
339 |
atattcactaagcttggaccaacttttgtcaaattgggtcaagggctgtctactagacccgatatttgtccatctga |
415 |
Q |
| |
|
|||||||| |||| |||||||||||||| || ||||||||||| |||||||||| || || ||||| ||| |||| |
|
|
| T |
17246 |
atattcacacagctaggaccaacttttgtgaagttgggtcaaggattgtctactaggcctgacatttgcccacctga |
17322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University