View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4271-Insertion-2 (Length: 211)
Name: NF4271-Insertion-2
Description: NF4271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4271-Insertion-2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 47494457 - 47494667
Alignment:
| Q |
1 |
ggtgattaattgtattgcttttgtatgtcaccttttcctccttaaaaagagagataagggggccaagtgtctaaatattttacaaacgctccaataggaa |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47494457 |
ggtggttaattgtattgcttttgtatgtcaccttttcctccttaaaaagagagataagggggccaagtgtctaaatattttacaaaccctccaataggaa |
47494556 |
T |
|
| Q |
101 |
ttttgagaaaaccatgattttgttcttaaagccaaggcatgcacacatataagccaactaacgtattctctcttaattaccaaaagcataatcaaatgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47494557 |
ttttgagaaaaccatgattttgttcttaaagccaaggcatgcacacatataagccaactaacgtattctctcttaattaccaaaagcataatcaaatgga |
47494656 |
T |
|
| Q |
201 |
gtacataagca |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
47494657 |
gtacataagca |
47494667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University