View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4271-Insertion-3 (Length: 109)
Name: NF4271-Insertion-3
Description: NF4271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4271-Insertion-3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 4e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 6 - 65
Target Start/End: Original strand, 19272686 - 19272745
Alignment:
| Q |
6 |
agtagcacttttgtaactaatattttttggtccataatctgacaagagaagatattatta |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19272686 |
agtagcacttttgtaactaatattttttggtccataatctgacaagagaagatattatta |
19272745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 63 - 109
Target Start/End: Original strand, 19273584 - 19273630
Alignment:
| Q |
63 |
ttaagtagcaaattatttcatgattgctctatgcatgtaccatattg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19273584 |
ttaagtagcaaattatttcatgattgctctatgcatgtaccatattg |
19273630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University