View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4271-Insertion-3 (Length: 109)

Name: NF4271-Insertion-3
Description: NF4271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4271-Insertion-3
NF4271-Insertion-3
[»] chr4 (2 HSPs)
chr4 (6-65)||(19272686-19272745)
chr4 (63-109)||(19273584-19273630)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 4e-26; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 6 - 65
Target Start/End: Original strand, 19272686 - 19272745
Alignment:
6 agtagcacttttgtaactaatattttttggtccataatctgacaagagaagatattatta 65  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19272686 agtagcacttttgtaactaatattttttggtccataatctgacaagagaagatattatta 19272745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 63 - 109
Target Start/End: Original strand, 19273584 - 19273630
Alignment:
63 ttaagtagcaaattatttcatgattgctctatgcatgtaccatattg 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
19273584 ttaagtagcaaattatttcatgattgctctatgcatgtaccatattg 19273630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University