View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4271-Insertion-7 (Length: 62)
Name: NF4271-Insertion-7
Description: NF4271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4271-Insertion-7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 1e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 1e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 4838831 - 4838892
Alignment:
| Q |
1 |
taaattatcaagtgtagttaagttttttaaacactaagtttgtagagaaagactctggtttg |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4838831 |
taaattatcaagtgtagttaagttttttaaacactaagtttgtagagaaagactctggtttg |
4838892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University