View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4272_high_10 (Length: 344)
Name: NF4272_high_10
Description: NF4272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4272_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 7 - 326
Target Start/End: Original strand, 52577680 - 52577999
Alignment:
| Q |
7 |
gcagcacagatgtggttccctgcactatatatatgttgctgttaagtcttggaaacattgtttttataaaaatgctttgatttgatgtgctagacgaaca |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52577680 |
gcagcacaaatgtggttccctgcactatatatatgttgctgttaagtcttggaaacattgtttttataaaaatgctttgatttgatgtgctagacgaact |
52577779 |
T |
|
| Q |
107 |
agcattttaattgaggggaggaacaaaagactatatattaagatgatgtttatattggaaatgcctaatcaccttattccctcttgagatgcgaaggttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52577780 |
agcattttaattgaggggaggaacaaaagactatatattaagatgatgtttatattggaaatgcctaatcaccttattccctcttgagatgcgaaggttt |
52577879 |
T |
|
| Q |
207 |
cctgaatgcgataagtatgtggtgtctaaccaaccctttgcttcatctccgagaagcttaaatggaactggatatggaactttaaatggaagaaatttga |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52577880 |
cctgaatgcgataagtatgtggtgtctaaccaaccctttgcttcatctccgagaagcttaaatggaactggatatggaactttaaatggaagaaatttga |
52577979 |
T |
|
| Q |
307 |
aagaaaaggcagctctgtca |
326 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52577980 |
aagaaaaggcagctctgtca |
52577999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University