View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4272_high_22 (Length: 281)
Name: NF4272_high_22
Description: NF4272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4272_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 6 - 257
Target Start/End: Complemental strand, 8355214 - 8354943
Alignment:
| Q |
6 |
caggagcagagagggattcagacaatcttaattgttcgtcttgattctaaatttaagttttaatttactttcaatttgtaaaccaacttggaatgcaaac |
105 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8355214 |
caggaacatagagggattcagacaatcttaattgttcgtcttgattctaaatttaagttttaatttactttcaatttgtaaaccaacttggaatgcaaac |
8355115 |
T |
|
| Q |
106 |
ccctgaaatttatatttgtatgacttataaaacatataaaatcatcctttttgag------------------tactataagaaagggaccaaaaccgat |
187 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8355114 |
ccctgaaatttatatttatatgacttataaaacatataaaatcatcctttttgagtttaaaaaaaaataaaaatactataagaaagggaccaaaaccgat |
8355015 |
T |
|
| Q |
188 |
agtttttaaaatgaatgaccaagtactccattattaaaggagcaatccgagta--attcaaggataggatag |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
8355014 |
agtttttaaaatgaatgaccaagtactccattattaaaggaccaatccgagtaatattcaaggataggatag |
8354943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University