View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4272_high_23 (Length: 277)
Name: NF4272_high_23
Description: NF4272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4272_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 25264585 - 25264479
Alignment:
| Q |
1 |
tgacaaaacttcaacaaaatcaacatcttccttcaacacagactcataaagtaactacctttttcatcattgcttctttgtttttaatgggtcattcata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25264585 |
tgacaaaacttcaacaaaatcaacatcttccttcaacacagactcataaagtaactacctttttcatcattgcttctttgtttttaatgggtcattcata |
25264486 |
T |
 |
| Q |
101 |
ggtgtct |
107 |
Q |
| |
|
||||||| |
|
|
| T |
25264485 |
ggtgtct |
25264479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 177 - 260
Target Start/End: Complemental strand, 25264411 - 25264328
Alignment:
| Q |
177 |
agcatgcccatttgtgttttttacagtaaagttttgaacttgcaatgtattaagtaattttatttttaaaatgcgacttacaat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25264411 |
agcatgcccatttgtgttttttacagtaaagttttgaacttgcaatgtattaagtaattttatttttaaaatgcgacttacaat |
25264328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University