View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4272_high_30 (Length: 247)
Name: NF4272_high_30
Description: NF4272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4272_high_30 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 49704948 - 49705177
Alignment:
| Q |
18 |
atgcagatcaagttgggnnnnnnntcagagtctgtgtgcaaataagtacttactgtgtggaataagtgcttttgtattgatgtgtgtgcccttttgagtg |
117 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49704948 |
atgcagatcaagttgggaaaaaaatcagagtttgtgtgcaaataagtacttactgtgtggaataagcacttttgtattgatgtgtgtgcccttttgagtg |
49705047 |
T |
 |
| Q |
118 |
ttttacttttggagatctaatatacttgtgagaaagagtgtgttttggaattggactaattgggtgtgagactaagaggaggattctttggtggggtaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49705048 |
ttttacttttggagatctaatatacttgtgagaaagagtgtgttttggaattggactaattgggtgtgagactaagaggaggattctttggtggggtaag |
49705147 |
T |
 |
| Q |
218 |
atatggcctccggtgaagggaggcggcatc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49705148 |
atatggcctccggtgaagggaggcggcatc |
49705177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University