View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4272_high_31 (Length: 240)
Name: NF4272_high_31
Description: NF4272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4272_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 104 - 228
Target Start/End: Complemental strand, 4472867 - 4472743
Alignment:
| Q |
104 |
ctattttgatttctcaattttacttaaataaatgtttaattcaacttctgaattaaagattaactgttaaaaattaagagatcaaaactgtacaacatca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4472867 |
ctattttgatttctcaattttacttaaacgaatgttcaattcaacttctgaattaaagattaacggttaaaaattaagagatcaaaactgtacaacatca |
4472768 |
T |
|
| Q |
204 |
atatgtgggtgtgaaccctatatat |
228 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
4472767 |
atacgtgggtgtgaaccctatatat |
4472743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 4473001 - 4472923
Alignment:
| Q |
1 |
tttgttttagatcaatgaaaatttatattttttcacataaaacttgtgaaatattatttttattaaacgatttgggattt |
80 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4473001 |
tttgttttagatcaatgaaa-tttatattttttcacataaaacttgtgaaatattatttttattaaacgatttgggattt |
4472923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University