View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4272_low_20 (Length: 302)
Name: NF4272_low_20
Description: NF4272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4272_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 134 - 300
Target Start/End: Original strand, 26496558 - 26496724
Alignment:
| Q |
134 |
gatagcactttgttatattaacttttaaaatatctcaacaaatatctacatcaacattattgaatccatcatgcatgtatgannnnnnnnnnnnngcagt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
26496558 |
gatagcactttgttatattaacttttaaaatatctcaacaaatatctacatcaacattattgaatccatcatgcatgtataatttttatttttttgcagt |
26496657 |
T |
 |
| Q |
234 |
gacaatgtataaaatagaaggaaattgattaccgatggtgtgatgaatttatcagtgaacgagcaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
26496658 |
gacaatgtataaaatagaaggaaattgattaccgatggtgtgatgaatttatcagtgagcaagcaga |
26496724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 17 - 90
Target Start/End: Original strand, 26496486 - 26496559
Alignment:
| Q |
17 |
acttatgtaggtgttataagttgttttcataagcttttccaaaaaacctcacaagtacttatgagaagtatgga |
90 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26496486 |
acttatgtaggtgttataagttattttcataagcttttccaaaaaacctcacaagtatttatgagaagtatgga |
26496559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University