View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4272_low_20 (Length: 302)

Name: NF4272_low_20
Description: NF4272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4272_low_20
NF4272_low_20
[»] chr8 (2 HSPs)
chr8 (134-300)||(26496558-26496724)
chr8 (17-90)||(26496486-26496559)


Alignment Details
Target: chr8 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 134 - 300
Target Start/End: Original strand, 26496558 - 26496724
Alignment:
134 gatagcactttgttatattaacttttaaaatatctcaacaaatatctacatcaacattattgaatccatcatgcatgtatgannnnnnnnnnnnngcagt 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |             |||||    
26496558 gatagcactttgttatattaacttttaaaatatctcaacaaatatctacatcaacattattgaatccatcatgcatgtataatttttatttttttgcagt 26496657  T
234 gacaatgtataaaatagaaggaaattgattaccgatggtgtgatgaatttatcagtgaacgagcaga 300  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||    
26496658 gacaatgtataaaatagaaggaaattgattaccgatggtgtgatgaatttatcagtgagcaagcaga 26496724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 17 - 90
Target Start/End: Original strand, 26496486 - 26496559
Alignment:
17 acttatgtaggtgttataagttgttttcataagcttttccaaaaaacctcacaagtacttatgagaagtatgga 90  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||    
26496486 acttatgtaggtgttataagttattttcataagcttttccaaaaaacctcacaagtatttatgagaagtatgga 26496559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University