View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4272_low_22 (Length: 286)
Name: NF4272_low_22
Description: NF4272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4272_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 2528806 - 2528530
Alignment:
| Q |
1 |
tttcaaatggtctgttttggtttttgtatgtagtgtttaggatttcacaattggaattcagttgagatttgtgagtgtctttgagcctgcatgcaaggga |
100 |
Q |
| |
|
||||||| ||||| || ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2528806 |
tttcaaagggtcttttgtggtttttgaatgtagggtttaggatttcacaattggaattcagttgagatttgtgagtgtctctgagcctgcatgcaaggga |
2528707 |
T |
 |
| Q |
101 |
tcagttttctgaattttgcttttgtatgtatatgcagagaaatggaagaattttgttaatttctctatgagaaacatgatgatttttaatttcataaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528706 |
tcagttttctgaattttgcttttgtatgtatatgcagagaaatggaagaattttgttaatttctctatgagaaacatgatgatttttaatttcataaata |
2528607 |
T |
 |
| Q |
201 |
ttttaccagcttgattgaatgaattttttgtctgacatgtttgttttgtttcattttcctgtctgatttgttctctg |
277 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528606 |
ttttaccagcttgattgaatcaattttttgtctgacatgtttgttttgtttcattttcctgtctgatttgttctctg |
2528530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University