View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4272_low_37 (Length: 236)
Name: NF4272_low_37
Description: NF4272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4272_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 134 - 222
Target Start/End: Original strand, 38241906 - 38241994
Alignment:
| Q |
134 |
gtggtctatccattaatgacgttgtagagcttatatggccccattaaacatccatactgataccatnnnnnnnggacctaagcaaaaat |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38241906 |
gtggtctatccattaatgacgtggtagagcttatatggccccattaaacatccatactgataccataaaaaaaggacctaagcaaaaat |
38241994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 38241782 - 38241848
Alignment:
| Q |
1 |
ctcattaggatatgaaaattgcataaactatgttggcttaaattaatgtacttttggtcacccaaattcac |
71 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38241782 |
ctcattaggatatgaaaattgcataaattatgttggctta----aatgtacttttggtcacccaaattcac |
38241848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University