View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4272_low_37 (Length: 236)

Name: NF4272_low_37
Description: NF4272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4272_low_37
NF4272_low_37
[»] chr4 (2 HSPs)
chr4 (134-222)||(38241906-38241994)
chr4 (1-71)||(38241782-38241848)


Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 134 - 222
Target Start/End: Original strand, 38241906 - 38241994
Alignment:
134 gtggtctatccattaatgacgttgtagagcttatatggccccattaaacatccatactgataccatnnnnnnnggacctaagcaaaaat 222  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||    
38241906 gtggtctatccattaatgacgtggtagagcttatatggccccattaaacatccatactgataccataaaaaaaggacctaagcaaaaat 38241994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 38241782 - 38241848
Alignment:
1 ctcattaggatatgaaaattgcataaactatgttggcttaaattaatgtacttttggtcacccaaattcac 71  Q
    ||||||||||||||||||||||||||| ||||||||||||    |||||||||||||||||||||||||||    
38241782 ctcattaggatatgaaaattgcataaattatgttggctta----aatgtacttttggtcacccaaattcac 38241848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University