View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4272_low_39 (Length: 205)

Name: NF4272_low_39
Description: NF4272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4272_low_39
NF4272_low_39
[»] chr8 (1 HSPs)
chr8 (18-163)||(41367299-41367444)


Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 41367444 - 41367299
Alignment:
18 ctctgataccaagttttcattccaagcacaaccagtacctccatgttagcagatttttgccttggtgaatgatatgatgctaaatggaacctgaaaaatg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41367444 ctctgataccaagttttcattccaagcacaaccagtacctccatgttagcagatttttgccttggtgaatgatatgatgctaaatggaacctgaaaaatg 41367345  T
118 aataactaaacgattataaatatgttaatctattaaaaacaatgta 163  Q
    |||||||||| || ||||||||| ||||||||||||||||||||||    
41367344 aataactaaatgaatataaatatattaatctattaaaaacaatgta 41367299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University