View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4273_low_7 (Length: 245)
Name: NF4273_low_7
Description: NF4273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4273_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 152
Target Start/End: Complemental strand, 2464536 - 2464402
Alignment:
| Q |
18 |
aaacttggctcctaatttccaccaattttaacgtagtttttattaaggtggattagattaaagggaaccaactcgagagtttaactttttgtgtagagtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2464536 |
aaacttggctcctaatttccaccaattttaacgtagtttttattaaggtggattagattaaagggaaccaactcgagagtttaactttctgtgtagagtg |
2464437 |
T |
|
| Q |
118 |
attaagaaatcaagctacaatatggactattcaac |
152 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
2464436 |
attaagaaatcaagctacaatatgtactattcaac |
2464402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 59 - 152
Target Start/End: Complemental strand, 2456646 - 2456552
Alignment:
| Q |
59 |
attaaggtggattagattaaagggaaccaactcgagagtttaactttttgtgta-gagtgattaagaaatcaagctacaatatggactattcaac |
152 |
Q |
| |
|
|||||||||||||||||||||||| || ||| ||||| |||||| ||| |||| || ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2456646 |
attaaggtggattagattaaagggcactaacccgagaatttaacatttggtgtttgactgattaagaaatcaagctacaatatgggctattcaac |
2456552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University