View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4273_low_8 (Length: 237)

Name: NF4273_low_8
Description: NF4273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4273_low_8
NF4273_low_8
[»] chr5 (1 HSPs)
chr5 (1-102)||(1819574-1819675)


Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 1819675 - 1819574
Alignment:
1 attaagataagataatatctaagtagggtggatatagatccacatgagatggtttttccttcttctatacaaaatttaaatcaatatcgattcacttgaa 100  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1819675 attaagataagataatatataagtagggtggatatagatccacatgagatggtttttccttcttctatacaaaatttaaatcaatatcgattcacttgaa 1819576  T
101 gc 102  Q
    ||    
1819575 gc 1819574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University