View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4274-Insertion-3 (Length: 131)
Name: NF4274-Insertion-3
Description: NF4274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4274-Insertion-3 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 6e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 6e-41
Query Start/End: Original strand, 43 - 131
Target Start/End: Original strand, 45048752 - 45048840
Alignment:
| Q |
43 |
attttcaaattaatgatattttaatgttgccttttgtggtctgattcttctttttctttgttttggcagattttgaagcattttatgag |
131 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45048752 |
attttcaaataaatgatattttaatgttgccttttgtggtctgattcttctttttctttgttttggcagattttgaagcattttatgag |
45048840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 131
Target Start/End: Complemental strand, 10671597 - 10671561
Alignment:
| Q |
95 |
tttctttgttttggcagattttgaagcattttatgag |
131 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
10671597 |
tttctttcttttggcagattttgaagcattatatgag |
10671561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University