View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4274-Insertion-4 (Length: 102)
Name: NF4274-Insertion-4
Description: NF4274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4274-Insertion-4 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 8e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 8e-49
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 6138679 - 6138780
Alignment:
| Q |
1 |
cgctgctcttgcacgtgaaggaccaagtacttatggtactacttctgctacttggtctccactttatagtcctcctcgtggtacaataggtctttttgaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6138679 |
cgctgctcttgcacgtgcaggaccaagtacttatggtactacttctgctacttggtctccactttatagtcctcctcgtggtacaataggtctttttgaa |
6138778 |
T |
|
| Q |
101 |
ga |
102 |
Q |
| |
|
|| |
|
|
| T |
6138779 |
ga |
6138780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University