View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4274-Insertion-6 (Length: 74)
Name: NF4274-Insertion-6
Description: NF4274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4274-Insertion-6 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 7e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 7e-30
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 6644134 - 6644207
Alignment:
| Q |
1 |
cttattgacgctacataatataatgttttgttgcaatatattgtacctttcagagattgcaaatcggttaacaa |
74 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6644134 |
cttattgatgctacataatatgatgttttgttgcaatatattgtacctttcagagattgcaaatcggttaacaa |
6644207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University