View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4274-Insertion-8 (Length: 65)
Name: NF4274-Insertion-8
Description: NF4274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4274-Insertion-8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 3e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 13 - 65
Target Start/End: Original strand, 55076328 - 55076380
Alignment:
| Q |
13 |
tgtacctcacaagtgggctgccaacatctggctatgtggtcccatatcaggca |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076328 |
tgtacctcacaagtgggctgccaacatctggctatgtggtcccatatcaggca |
55076380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 15125714 - 15125675
Alignment:
| Q |
24 |
agtgggctgccaacatctggctatgtggtcccatatcagg |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
15125714 |
agtgggctgccaacatctggctatgtggtccaatttcagg |
15125675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University