View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4275-Insertion-1 (Length: 62)
Name: NF4275-Insertion-1
Description: NF4275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4275-Insertion-1 |
 | |
|
| [»] scaffold0036 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 51; Significance: 5e-21; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 51; E-Value: 5e-21
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 91255 - 91312
Alignment:
| Q |
1 |
tgattgagtttgcttgggggttaagtaacagtaaaaaaccgtttttagtgggtcataag |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
91255 |
tgattgagtttgcttgggggttaagtaacagtaaaaaaccgttttt-gtgggtcataag |
91312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University