View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4275-Insertion-3 (Length: 128)
Name: NF4275-Insertion-3
Description: NF4275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4275-Insertion-3 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 5e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 21126949 - 21126821
Alignment:
| Q |
1 |
catatgttagaggatgttttgattttcatcttaatatgattgaaacaattgaaagaaaa-tttaaatgcttgtcccgttaaaggttcccatgcatccagt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21126949 |
catatgttagaggatgttttgattttcatcttgatatgattgaaacaattgaaagaaaaatttaaatgcttgtcccgttaaaggttcccatgcatccagt |
21126850 |
T |
|
| Q |
100 |
ttgccaacatctgaagtgcagcttttggt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21126849 |
ttgccaacatctgaagtgcagcttttggt |
21126821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 83 - 128
Target Start/End: Complemental strand, 21146960 - 21146915
Alignment:
| Q |
83 |
gttcccatgcatccagtttgccaacatctgaagtgcagcttttggt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21146960 |
gttcccatgcatccagtttgccaacatctgaagtgcagcttttggt |
21146915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University