View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4275_high_1 (Length: 420)
Name: NF4275_high_1
Description: NF4275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4275_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 31 - 403
Target Start/End: Complemental strand, 39306800 - 39306428
Alignment:
| Q |
31 |
aacagatatcgattgcgtttattgattcaaacacaaaatgaacacggaagacacatctccggcagccgccataacacggtggaaattcgaagcatcacgg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39306800 |
aacagatatcgattgcgtttattgattcaaacacaaaatgaacacggaagacacatctccggcagccgccataacacggtggaaattcgaagcatcacgg |
39306701 |
T |
|
| Q |
131 |
cggtaccaacacattctcgacaaatcaacgccgcacgtcagtcaacgatggttagggtgccttgtggttgcattggtttacgttcttcgcgtttacatcg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39306700 |
cggtaccaacacattctcgacaaatcaacgccgcacgtcagtcaacgatggttagggtgccttgtggttgcattggtttacgttcttcgcgtttacatcg |
39306601 |
T |
|
| Q |
231 |
tgcaaggcttctacgttgtttcttacggtcttggcatttatatcttgaaccttttgattggatttctttcgcctcaggttgatcccgagattcttgatgc |
330 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39306600 |
tgcaaggcttctacgttgtttcgtacggtcttggcatttatatcttgaaccttttgattggatttctttcgcctcaggttgatcccgagattcttgatgc |
39306501 |
T |
|
| Q |
331 |
tgataatggtccttcgcttccgacttctggttctgatgagtttcgtccttttgttcgtcgtcttcctgagttt |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39306500 |
tgataatggtccttcgcttccgacttctggttctgatgagtttcgtccttttgttcgtcgtcttcctgagttt |
39306428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University