View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4275_high_7 (Length: 303)
Name: NF4275_high_7
Description: NF4275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4275_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 296
Target Start/End: Original strand, 4468553 - 4468849
Alignment:
| Q |
1 |
aacgcctcactggctagctcagttctagattcgtgatcaggtgtaacacccccaacag-tagtaatagtcgttggagctgaacactgataaacgtcgtat |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4468553 |
aacgcctcaatggctagctcagttctagattcttgatcatgtgtaacacccccaacggctagtaatagtcgttggagctgaacactgataaacgtagtat |
4468652 |
T |
 |
| Q |
100 |
gtaacgaaccctttgtcagtctctaacaactccttgtcagtgcctataaaatacatgcttctttcaccacaaatgcaaggtacacaatttgtcaatttat |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468653 |
gtaacgaaccctttgtcaatctctaacaactccttgtcagtgcctataaaatacatgcttctttcaccacaaatgcaaggtacacaatttgtcaatttat |
4468752 |
T |
 |
| Q |
200 |
atccactttctatctcatactctttgctcaatcattgacttgaacgtcagagtgactgcaggtactgacctaacgtcaatctcgaccaattcatctc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4468753 |
atccactttctatctcatactctttgctcaatcattgacttgaacgtcagagtgactgcaggtactgacctaacgtcaatctcgaccaattcatctc |
4468849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University