View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4275_high_8 (Length: 299)
Name: NF4275_high_8
Description: NF4275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4275_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 39 - 285
Target Start/End: Original strand, 2555929 - 2556175
Alignment:
| Q |
39 |
tcactacgtcttcacgaatttctctctctcccaaaatctaacgtgtcttctagaaaacaaagggcaagaccattctcaccggtgatgaatccatagttgc |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2555929 |
tcactacgtcttcacgaatttctctctctcccacaatctaacgtgtcttctagaaaacaaagggcaagaccattctcaccggtgatgaatccatagttgc |
2556028 |
T |
 |
| Q |
139 |
cgcttccatggttgtccttaacatcgtcgtaatggaagaaaccaccgaaataaatctccagcttcatgtttcactttctcaattggatagcaccacaata |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2556029 |
cgcttccatggttgtccttaacatcgtcgtaatggaagaaaccaccgaaataaatctccagcttcatgtttcactttctcaattggatagcaccacaata |
2556128 |
T |
 |
| Q |
239 |
ctacaaatggcaaaaatctgaaaaagtttcatttttcaggaggagat |
285 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2556129 |
ctacaaatgacaaaaatctgaaaaagtttcatttttcaggaggagat |
2556175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University