View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4275_low_11 (Length: 256)
Name: NF4275_low_11
Description: NF4275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4275_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 25 - 251
Target Start/End: Complemental strand, 8583815 - 8583597
Alignment:
| Q |
25 |
aaatacatgcttttaaaaaatgcgactaatttatcccatccaaaccaattaaatttgattgaatcgaataactcttttgattaaacgcggtctgacccaa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
8583815 |
aaatacatgcttttaaaaaatgcgactaatttatcccatccaaaccaattaaatttgattgaatcgagt-------ttgattaaacgcggtccgacccaa |
8583723 |
T |
 |
| Q |
125 |
atcacacctt-aactcaactgggtcggataacatttgtaccaaacccggtccgacccaacttgcatcttaaactcttgaacaagcaaaactcactttata |
223 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
8583722 |
atcacgcctttaactcaactgggtcggataacatttgtaccaaacccggtccgacccaacttgcatcttaaactcttgaacaagc-aaattcactttata |
8583624 |
T |
 |
| Q |
224 |
ttttccttttactttttcttcttctcac |
251 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
8583623 |
-tttcctttttctttttcttcttctcac |
8583597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University