View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4275_low_4 (Length: 373)
Name: NF4275_low_4
Description: NF4275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4275_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 18 - 302
Target Start/End: Original strand, 41990542 - 41990824
Alignment:
| Q |
18 |
gatacatgttcaacaaatgggtgttctccatgctacactctttcaaatcttcttcatctttgttgtttccacgtgcctcacttgtttgtacataaatgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41990542 |
gatacatgttcaacaaatgggtgttctccatgctacactctttcaaatcttcttcatctttgttgtttccacgtgcctcacttgtttgta--taaatgtt |
41990639 |
T |
|
| Q |
118 |
aaaatatttttactatcttggtatgcatatgaagtaaaattttactacaatttcaatacttaaacaaaacaattattggacataatttgtttacttttcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41990640 |
aaaatatttttactatcttggtatgcatatgaagtaaaattttactacaatttcaatacttaaacaaaacaattattggacataatttgtttacttttag |
41990739 |
T |
|
| Q |
218 |
atcaaatatcaatcttaccacaaagtcaatttactcgtaaacaatttttggataaattttatttactttccgatcaacctttttc |
302 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
41990740 |
atcaaatatcgatcttaccacaaagtcaatttactcgtaaacaatttttggataaactttatttactttccgatcaacatttttc |
41990824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 321 - 358
Target Start/End: Original strand, 39429434 - 39429471
Alignment:
| Q |
321 |
cacaaactgcctgaaagaaaatttgtaccggttcgttt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39429434 |
cacaaactgcctgaaagaaaatttgtaccggttcgttt |
39429471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University