View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4276-Insertion-10 (Length: 166)
Name: NF4276-Insertion-10
Description: NF4276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4276-Insertion-10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 6e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 6e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 12796241 - 12796098
Alignment:
| Q |
10 |
aaattttagatttttaataaactgaactgaagtgagtattggctattgaattattgaaaacatgatatcctaattgttgttttatgttcttttctgagtg |
109 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
12796241 |
aaattttagatttttaataagctgaactgaagtgagtattgagtattgaa-------aaacatgctatcctaattgttgttttatgttcttttcagagtc |
12796149 |
T |
 |
| Q |
110 |
accattcatattatttgctctatttgaaactgcttgactttgtttctttgt |
160 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12796148 |
accattcatattagttgctctatttgaaactgcttgactttgtttctttgt |
12796098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University