View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4276-Insertion-12 (Length: 167)
Name: NF4276-Insertion-12
Description: NF4276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4276-Insertion-12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 3e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 3e-80
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 7757002 - 7757168
Alignment:
| Q |
1 |
ccttatacaaccatgcaaagttcaatctatgacaacttcaaaagtgcttttttgaaagctgctttatctatgaacatctctagggtagattctgtggcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7757002 |
ccttatacaaccatgcaaagttcaatctatgcaaacttcaaaagtgctattttgaaagctgctttatctatgaacatctctagggtagattctgtggcac |
7757101 |
T |
 |
| Q |
101 |
cctttgagatttgttttggttctaatggaattggtgagtcaaaaattgggcctaatgtgccagtaat |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7757102 |
cctttgagatttgttttggttctaatggaattggtgcgtcaaaaattgggcctaatgtgccagtaat |
7757168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University