View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4276-Insertion-5 (Length: 280)
Name: NF4276-Insertion-5
Description: NF4276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4276-Insertion-5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 29138995 - 29138714
Alignment:
| Q |
1 |
gtttcaaatgacttgttcttcatgtctactctgtccataaagtgtgtgaagtgtcccttttgtcttcactgttttcttgtccttcacactttggtggaat |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29138995 |
gtttcaaatgacttgttctttatgtctactctgtccataaagtgtgtgaagtgtcccttttgtcttcactgttttcttgtccttcacactttggtggaat |
29138896 |
T |
 |
| Q |
101 |
tttatttactaccaaaattacctttctctctctacgcttttctaatgaaaattacacttgatttgggaaga--aaaatgttattaagacactaactaaaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
29138895 |
tttatttactaccaaaattacctttctctctctacgcttttctaatgaaaattacacttgatttgggaagaaaaaaatgttattaagacaccaactaaaa |
29138796 |
T |
 |
| Q |
199 |
tatgtttttcaacattatttattgattgagattgaaatttaaatatgtttagtaaattatttaaatgagagaaattacattc |
280 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29138795 |
tatgtttttcaacatcatttattgattgagattgaaatttaaatatgtttagtaaattatttaaatgagagaaattacattc |
29138714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University