View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4276-Insertion-8 (Length: 192)
Name: NF4276-Insertion-8
Description: NF4276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4276-Insertion-8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 4e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 11 - 192
Target Start/End: Complemental strand, 45707015 - 45706834
Alignment:
| Q |
11 |
ttaccttggcatgcttgactggcaaaatccttggttcctttgactcgctcctcccaccacggctttgtttcttcataactactaacatgtctataaatca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45707015 |
ttaccttggcatgcttgactggcaaaatccttggttcctttgactggctcctcccaccacggctttgtttcttcataactactaacatgtctataaatca |
45706916 |
T |
 |
| Q |
111 |
taaacaattgtcactttaagtcttaaacataatttataattatatgctagaacaatacatttgatttttacctgagaaaggt |
192 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45706915 |
taaacatttgtcactttaagtctaaaacataatttataattatatgctagaacaatacatttgatttttacctaagaaaggt |
45706834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University