View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4276_high_4 (Length: 255)
Name: NF4276_high_4
Description: NF4276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4276_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 237
Target Start/End: Original strand, 34942616 - 34942841
Alignment:
| Q |
12 |
aagcaaaggttaactaagctcacgtaacacatgcatcatgtgcttataaagcatgcccatgcaaatctcagttggtttatagtcattgcgtctcagcaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
34942616 |
aagcaaaggttaactaagctcacgtaacacatgcatcatgtgcttataaagcatgcccatgcaaatctcagttagtttatagtcattgagtctcagcaaa |
34942715 |
T |
|
| Q |
112 |
aaattcctctggcaccaaacttcattcttcatcaaaagttaatgattgaaatctcacgcattatctctcttatttctcttctattccgcaagcttttgga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34942716 |
aaattcctctggcaccaaacttcattcttcatcaaaagttaatgattgaaatctcacgcattatctctcttatttctcttctattccgcaagcttttgga |
34942815 |
T |
|
| Q |
212 |
ttcataactgtcacgtataaggcaaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
34942816 |
ttcataactgtcacgtataaggcaaa |
34942841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University