View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4276_low_8 (Length: 250)
Name: NF4276_low_8
Description: NF4276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4276_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 4 - 239
Target Start/End: Complemental strand, 18638999 - 18638764
Alignment:
| Q |
4 |
aggtgtatgtgtctgtgctcgtgtctatgtatatgttgaagcttcattgattgtataagctatggcggtatcaacattttttcaacatctgttatagtta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18638999 |
aggtgtatgtgtctgtgctcgtgtctatgtatgtgttgaagcttcattgattgtataagctatggtggtatcaacattttttcaacatctgttatagtta |
18638900 |
T |
 |
| Q |
104 |
taacagagaatggtttgttagttttcgtcttaaatgttctatctcttgttagttttactgcctaaatagtactgttgttattgttgtaaagttggcacga |
203 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18638899 |
taacagagaatggtttgttagtttttgtcttaaatgttgtatctcttgttagttttactgcctaaatagtactgttgttattgttgtaaagttggcacga |
18638800 |
T |
 |
| Q |
204 |
ttcttgccccttacgacactctttccttggtttcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
18638799 |
ttcttgccccttacgacactctttccttggtttcat |
18638764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University