View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4277-Insertion-15 (Length: 50)
Name: NF4277-Insertion-15
Description: NF4277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4277-Insertion-15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 50; Significance: 1e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 42006584 - 42006633
Alignment:
| Q |
1 |
agctcatccaagccgaattctccctttcatccattgccaaagtcatttta |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42006584 |
agctcatccaagccgaattctccctttcatccattgccaaagtcatttta |
42006633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 28; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 33820038 - 33820073
Alignment:
| Q |
1 |
agctcatccaagccgaattctccctttcatccattg |
36 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
33820038 |
agctcatccaatccgaattctccccttcatccattg |
33820073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University